Gene Paragraphs at TGD Wiki
| Paragraph No | Paragraph Text | Gene Name |
| 1 | The PDD1 gene encodes Pdd1p, an abundant protein whose expression is limited to the sexual phase of the Tetrahymena life cycle. Somatic knockout cells lacking Pdd1p during the early stages of conjugation and macronuclear development exhibit defects in a variety of developmental processes, including programmed DNA elimination, macronuclear genome endoduplication, and nuclear resorption. While Pdd1p is not required for vegetative growth, exconjugants derived from matings of somatic knockout cells are inviable. Originally identified during a screen for proteins upregulated during macronuclear development (which also led to the cloning of PDD2 and PDD3), the gene encoding p65 (Pdd1p) was cloned and shown to encode a novel protein composed of three chromodomains. Methylated histone binding activity has been demonstrated in vitro for one chromodomain of Pdd1p, specifically to methylated lysine-9 residues of histone H3. This histone modification is required for programmed DNA elimination, and like Pdd1p, these modified histones colocalize with chromatin containing the DNA sequences destined for elimination. Distribution of Pdd1p in the cell over time follows a remarkable pattern that is suggestive of its major role in programmed DNA elimination: Pdd1p is initially restricted to the old macronucleus, then relocalizes to the developing macronucleus when it is formed. Studies have long suggested an epigenetic contribution from the parental macronucleus that specifies the elimination of specific DNA sequences. The timing of its localization and its ability to bind chromatin suggests Pdd1p is directly involved in communicating this information to the new macronucleus. | PDD1 |
| 2 | A proposed model for the mechanism of programmed DNA elimination in Tetrahymena is based on the timing of expression, cellular distribution, mutant phenotypes, and predicted functions of the protein and RNA components involved. In this model, both strands of the micronuclear genome (or perhaps only the portions containing internal eliminated sequences) are transcribed early in conjugation to produce large non-genic, double-stranded RNAs. This transcription is likely performed by RNA Polymerase II, based on the localization of its subunit Rpb3p to the micronucleus during this time. These transcripts pass to the cytoplasm where they are processed into short (~28 nucleotide) scan RNAs (scnRNA) by the dicer-like protein Dcl1p, similar to the production of the small inhibitory RNAs (siRNA) central to the RNA interference (RNAi) pathway of other eukaryotes. The scnRNAs complex with Twi1p, a member of the PPD (PAZ and Piwi Domain) protein family, whose members are commonly involved in RNAi and related processes. The scnRNA/Twi1p complexes enter the old macronucleus, where scnRNAs homologous to DNA sequences found there are degraded. The remaining scnRNAs, comprised of micronuclear-restricted sequences, are transferred to the developing macronucleus. There, histone H3 proteins (Hht1p, Hht2p) that are bound to sections of the genome sharing identity to the scnRNAs are methylated on lysine-9. This modification, which is often associated with the formation of heterochromatin, is recognized by one or more of the chromodomains belonging to Pdd1p and Pdd3p. Regions of DNA associated with these modified histones are eliminated from the developing macronuclear genome. | TWI1, HHT2, PDD1, PDD3, DCL1 |
| 3 | Cyclin-dependent kinases (cdks) are a family of serine-threonine kinases that are involved in cell cycle control and cell division in eukaryotes. Cdks are catalytic subunits that are activated by association with proteins called cyclins, forming cyclin-cdk complexes. Cdk kinase activity is regulated by cyclin binding, phosphorylation and dephosphorylation, protein degradation, protein-protein interactions with cdk inhibitors, and subcellular localization. | CDK1 |
| 4 | Tetrahymena thermophila Cdk1p shares homology with cdk homologs from other eukaryotes. It contains 11 catalytic domains characteristic of protein kinases, conserves all of the regulatory phosphorylation sites found in cdks, and has a slightly modified cyclin-binding PSTAIRE motif that is a hallmark of cdks. The Tetrahymena thermophila Cdk1p was also found to bind Saccharomyces cerevisiae p13suc1, a yeast cyclin. | CDK1 |
| 5 | The level of Cdk1p fluctuates over the vegetative cell cycle, correlating with its histone H1 kinase activity. Cdk1p is associated with the basal bodies of the ciliary rows of the cell cortex and the oral apparatus. This localization, along with the phenotype of a partial CDK1 knockout phenotype of bent and buckled ciliary rows, suggests that Cdk1p is involved in cortical morphogenesis. | CDK1 |
| 6 | HEH2 is expressed during vegetative growth of T. thermophila and its protein product has been localized to basal bodies. Interestingly, its protein product was found to have high sequence similarity to the human disease gene KIAA1279. Human KIAA1279 was also found to have homologs in fruit fly, frog, rat, mouse, bee, chicken, and Japanese puffer fish, but none in Saccharomyces cerevisiae. Although the function of KIAA1279 is not yet known, evidence suggests that KIAA1279 is important in the development of the enteric and central nervous system (CNS). KIAA1279 was expressed in different parts of the adult CNS, and mutations in KIAA1279 were associated with Goldberg-Shprintzen syndrome (OMIM). | HEH2 |
| 7 | HEH2 appears to be located on the right arm of micronuclear chromosome 2 based on mapping REP6, a locus upstream of HEH2. | HEH2 |
| 8 | The HHO1 gene encodes the macronuclear linker histone H1 protein; the MLH1 gene encodes a polyprotein comprising a set of four micronuclear linker histone proteins (alpha, beta, gamma, and delta) unrelated to Hho1p. Histone H1 and the MLH proteins are chromatin proteins that associate with the inter-nucleosomal (linker) DNA. T. thermophila has two nuclei, one of which is transcriptionally active (the macronucleus) and one that is silent during most of the life cycle (the micronucleus). Furthermore, the macronucleus undergoes amitosis, whereas the micronucleus undergoes typical mitosis. The fact that Hho1p and MLH proteins are found exclusively in the macronucleus and micronucleus, respectively, has led to studies of their function, or lack of function, in transcription regulation, mitosis, and amitosis. Surprisingly, an HHO1 knockout showed this gene to be non-essential; its main observable phenotype was an overall decondensation of macronuclear chromatin. MLH1 knockouts, which are also viable, showed a similar phenotype in the micronucleus. | HHO1, MLH1 |
| 9 | HHO1 knockouts show no global increase or decrease in the amount of transcription in the cell; however, these same knockouts also show that Hho1p is important for the transcriptional regulation of individual genes in response to stimuli, such as starvation. The differential regulation of Hho1p by phosphorylation under vegetative growth and starvation conditions has been well studied. During vegetative growth, Hho1p is phosphorylated on five closely spaced residues, preventing it from interacting with chromatin, likely by interfering with its ability to bind DNA. Under these conditions, expression is increased for CDC2, a homolog of the cyclin dependent kinases responsible for histone H1 phosphorylation, possibly creating a positive feedback loop that promotes the cell cycle. During starvation conditions, Hho1p is dephosphorylated, allowing it to bind to chromatin. This stimulates the expression of some genes, including ngoA, and protease genes such as CYP1, while inhibiting expression of other genes, such as CDC2. This decrease in CDC2 expression may be responsible for cell cycle arrest during starvation. | HHO1, CDC2, NgoA, CYP1 |
| 10 | Proteins of the myosin superfamily are ATP-dependent molecular motors that travel unidirectionally along actin filaments. The myosin heavy chain proteins are comprised of three domains: a head (motor) domain responsible for ATP hydrolysis at the N-terminus, a neck (lever arm) region, and a C-terminal tail region. Thirteen predicted myosin heavy chain genes have been identified in the Tetrahymena genome and named MYO1-MYO13. A phylogenetic analysis comparing these predicted proteins with the 19 previously identified myosin classes suggests that Myo1p-Myo12p belong to a previously undescribed class of myosins. This new family, designated Class XX, does not include Myo13p, which did not branch with this class or any of the other classes in the analysis. The neck and tail regions of the Tetrahymena myosins include a variety of domains characterized in other myosin classes, with each protein containing one or more of the following domains: coiled-coil (which may support dimerization); IQ motif (binding sites for calmodulin or calmodulin-like proteins); FERM domain (Four-point-one protein, Ezrin, Radixin, Moesin homology); and MyTH4 domain (Myosin Tail Homology 4). | MYO1, MYO2, MYO3, MYO4, MYO5, MYO8, MYO9, MYO10, MYO11, MYO12, MYO13 |
| 11 | A recessive gene determining temperature-sensitive fission arrest was described in 1976 under the name "mo1". Around 1979, following the (then) new nomenclatural rules, it was re-named cdaA1 (CDA="cell division arrest"). In the early 1980's, Y. Watanabe and his associates made some remarkable findings reported in 1986. Using 2D-gel electrophoresis, they found a protein, which they called p85 (later renamed Cmb1p), which was localized to the oral apparatus and also to an apical filament ring and to structures (which turned out to be basal-body couplets) located just posterior to the division furrow. The equatorial localization was observed in cdaA1 homozygotes at the permissive temperature (when division took place), but not after a shift to the restrictive temperature (when the division furrow failed to develop). Based on these studies it was naturally assumed that p85 was the protein product of the cdaA gene, especially as p85 differed slightly in mobility in 2D-gels made from wild-type and cdaA1 cell extracts. However, in 1999 the gene encoding p85 was cloned. This yielded a big surprise: "The cdaA1 p85 cDNA contained one open reading frame and its deduced amino acid sequence, cdaA1 p85, was completely identical to that of wild-type p85" (p. 116). There were some differences in the 3'UTR and 5' UTRs, but they "do not affect the transcription and translation of the p85 gene, because the amounts of transcribed mRNA and translated protein of cdaA1 p85 were equivalent to those of wild type p85" (p. 118). The authors conclude the Results section as follows: "Thus, we suppose that the difference in molecular weight between cdaA1 and wild-type p85 was caused by a disorder of post-translational modification mechanisms of p85 in cdaA1 cells." (p. 116). These results demonstrate that p85 is likely not the product of the cdaA1 gene, and that the gene mutated in the cdaA1 strain is more likely to be a protein responsible for the post-translational modification of p85, which is altered in the cdaA1 mutant. (Contributed by J. Frankel, University of Iowa, 2005) | CMB1 |
| 12 | THD1, a homolog of the Saccharomyces cerevisiae Rpd3p, a class I histone deacetylase (HDAC), is localized to the macronucleus during vegetative growth, and distributed to developing new macronuclei early in their differentiation. Thd1p deacetylates all four core histones in vitro. Thd1p is a 52kDa polypeptide in an HDAC complex of approximately 160 kDa. | THD1 |
| 13 | Tetrahymena cells with reduced Thd1p expression exhibited phenotypes indicative of loss of chromatin integrity, such as DNA fragmentation and extrusion of chromatin from the macronucleus, variable macronuclear size and shape, enlarged nucleoli, and reduced phosphorylation of histone H1 from bulk chromatin. Macronuclei in THD1 knockdown cells also contained more DNA, suggesting Thd1p may play a role in regulating macronuclear DNA content. The THD1 gene could not be completely replaced by a disruption construct, suggesting that THD1 is an essential gene. | THD1 |
| 14 | A macronuclear chromosome containing a fusion gene was cloned from the spirotrichous ciliate Oxytricha trifallax. The gene encodes a single polypeptide containing homologs of two proteins that catalyze sequential steps in the formaldehyde detoxification pathway in Saccharomyces cerevisiae. These two proteins are formaldehyde dehydrogenase (FALDH) and S-formylglutathione hydrolase (SFGH); the fusion gene is called FSF1 (FALDH/SFGH Fusion 1). A similar gene was identified in the Tetrahymena thermophila genome sequence, and a T. thermophila EST sequenced from both ends showed that the fusion gene is expressed in this species in vivo. FSF1 has not yet been identified in other ciliates, but a fusion of these two genes has been identified in another group of protists, the diatoms. An EST from Phaeodactylum tricornutum and a gene from the genome sequence of Thalassiosira pseudonana both encode a fusion of these two genes, but in the opposite orientation of the ciliate genes. In diatoms, the SFGH domain is found N-terminal to the FALDH domain, suggesting that these two fusion genes evolved independently in ciliates and diatoms. The diatom genes were named SFF1 to highlight these differences. | FSF1 |
| 15 | Spo11p induces DSBs and at the same time triggers the elongation of meiotic nuclei (crescents) via an ATR-dependent response in Tetrahymena. The crescent resembles the conserved bouquet arrangement and the fission yeast horsetail nucleus. It promotes meiotic chromosome pairing. Thus, by nuclear elongation and the ensuing close juxtapositioning of homologous chromosome regions within the tubular nucleus, Spo11p ensures that DSBs formed by its activity can be repaired by homologous recombination. | SPO11 |
| 16 | HOP2B is a homolog of budding yeast HOmologous Pairing 2. It is essential for vegetative growth. HOP2B has a meiosis-specific paralog in Tetrahymena (HOP2, HOP2A, TTHERM_00794620) which is the yeast HOP2 ortholog. | HOPP2 |
| 17 | Knockout prevents SPO11-dependent elongation of meiotic nuclei. Involved in the signaling of meiotic DSBs and other DNA damage. | ATR1 |
| 18 | MBD1 is a gene fusion of two genes involved in the methionine salvage pathway: methylthioribulose-1-phosphate dehydratase -mtnB; and 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase - mtnD. These enzymes catalyze non-consecutive steps in the pathway. Interestingly the gene that codes for the intervening enzyme in the pathway, mtnC, is missing from the genome of Tetrahymena. Complementation tests in yeast were used to show that MBD1 from Tetrahymena is able to do in one step what yeast does in three, since it can rescue yeast knockouts of mtnB, mtnC, or mtnD (Salim, Negritto and Cavalcanti 2009). | MBD1 |
| 19 | The phospholipid flippase family of genes in Tetrahymena contains 20 members, FLP1-FLP20. Preliminary studies show that many of these genes are differentially regulated in response to temperature and/or the presence of a polycyclic aromatic hydrocarbon (pyrene). | FLP11, FLP5, FLP7, FLP4, FLP12, FLP9, FLP3, FLP1, FLP2, FLP10, FLP13, FLP6, FLP14, FLP15, FLP16, FLP8, FLP17, FLP18, FLP19 |
| 20 | 19 | |
| 21 | 2 | |
| 22 | LIA4 is expressed exclusively during conjugation and Lia4p localizes to developing macronuclei. It is required for completion of conjugation, DNA rearrangement, chromosome breakage, and Pdd1 foci (dumposome) formation (Horrell SA and Chalker DL, unpublished data). | LIA4 |
| 23 | ABC3 shares homology with ABC transporter proteins from other eukaryotes. It contains an ATP-binding domain that hydrolyzes ATP in to provide energy for the protein to translocate various molecules across a biological membrane. Paragraph by undergraduates at the Keck Science Department, Pitzer College | ABC3 |
| 24 | Solute Transport Facilitator 1 (STF1) is a protein from the major facilitator superfamily (MFS), one of the largest families of membrane transports known, found in archaea, bacteria, and eukaryotes. This protein is predicted to have a MFS1 domain (E-value 1e-08), and is likely to transport small solutes through the membrane through either uniport, symport, or antiport. Paragraph by: Lisette Espinosa and Charles McGregor (undergraduates), Keck Science Department, Claremont McKenna College | STF1 |
| 25 | NHX1 is an integral membrane protein that shares homology with other proteins containing a sodium hydrogen exchanger domain involved in transporting sodium and hydrogen ions across the concentration gradient between a cell and its surroundings. Functioning as an antiporter for sodium and hydrogen ions, the exchange function characteristic of this domain is highly dependent on pH. Although the exact molecular mechanisms responsible for this behavior are not well understood, a prominent current inference is that these exchanger proteins use ATP to transport ions across membranes. Paragraph by: Samuel Rubin and Owen Foster (undergraduates) Keck Science Deparment, Claremont Colleges | NHX1 |
| 26 | NHX2 belongs in the family of sodium-hydrogen exchangers that act as antiporrters that maintain the pH of actively metabolizing cells by controlling the balance of sodium. THe antiporters have 10-12 regions on the N-terminus and a large cytoplasmic region on the C-terminus. The 10-12 transmembrane regions contain 2 highly conserved regions and most of the regions share identities within the family , while the large cytoplasmic region is noted to have little similarity with other members in the family. Paragraph by: Chris Fang and Deanna Liou (undergraduates) Keck Science Department, The Claremont Colleges | NHX2 |
| 27 | GTP4 has only one known functional domain and is a member of the sugar transporter family, a subset of the major facilitator superfamily (E-value: 5.4e-36). This protein appears to be responsible for transporting sugar across the plasma membrane in response to changes in the electrochemical gradient, specifically in sugar uptake. Paragraph by: Kathleen Beardsworth and Kristen Keller (undergraduates), Keck Science Department, Claremont Colleges. | GTP4 |
| 28 | ABC2 shares homology with members of the ABC family transporter proteins. This protein appears to have two types of domains. It is thought that the two domains function together to bind ATP to transport substances such as glutathione, glucuronate, and sulfate across the membrane. Using energy from ATP hydrolysis, both domains of ABC transporters facilitate the transport of a wide variety of materials out of the cell. Paragraph by undergraduates from the Keck Science Department at Claremont McKenna and Scripps Colleges | ABC2 |
| 29 | Tetrahymena thermophila MAF4 is homologous with proteins from the WD40 superfamily, mostly membrane and flagellar associated proteins. It contains two domains; the first domain (E-value=1.95E-5), in the clathrin family, indicates that the protein could have a membrane spanning domain due to repeated alpha-helices. The second domain (E-value=7.46E-3) is a kinase complex, which indicates possible movement function, and correlates with the homologs being flagellar associated proteins. It is possible that this protein is an integral membrane protein that has a function in flagellar movement. Paragraph by: Lauren Mitten and Rebecca Dutta (undergraduates), Keck Science Department, Scripps College | MAF4 |
| 30 | PKC2 shares homology with a number of Protein Kinase C related proteins in other ciliated prokaryotes. PKC2 contains only one single domain across its entire 517 amino acids. It conserves most of the protein kinase domain, and contains a 241 amino acid region with unknown function. PKC2 appears to play a role in amplifying the message of signal transduction pathways by phosphorylating serine and threonine. This induces a conformational change in a targeted protein and subsequently leads to a cellular response. Paragraph by: Jacqueline Kroll and Rachel Brunetti (undergraduates), Keck Science Department, The Claremont Colleges. | PKC2 |
| 31 | Tetrahymena thermophilia PMR1 (potential mRNA regulator) is homologous to proteins from the LRR_RI domain. The domain suggests that the protein is similar to Leucine rich repeat, ribonucleus inhibiter (Evalue = 7.51 × 〖10〗^(-6)). The leucine rich protein may form tight complexes with a certain ribonuclease, or may be involved in other protein-protein interactions. It is possible that the PMR plays a role in regulating the lifetime of RNA like the ribonuclease inhibitor. Paragraph provided by undergraduates at the Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges. | PMR1 |
| 32 | Tetrahymena thermophile TIT1 is homologous with proteins from a cation channel family. It contains one domain: the ion transport protein (Evalue: 1x10⁻⁸) whose function is to selectively transport ions through the membrane. It is possible that this protein is an integral membrane protein that has a critical function in facilitating ion transport. Transmembrane Ion Channel Family proteins that are found in eukaryotes tend to have up to four additional transmembrane helices. These additional helices help explain the physical properties of the protein. We have determined that TIT1 has a sequence that consists of 604 amino acids, a relatively lengthy sequence. Paragraph by: Kristiana Kim and Will Su(undergraduates), Keck Science Department, Scripps College, Claremont McKenna College | |
| 33 | Tetrahymena thermophile TIT1 is homologous with proteins from a cation channel family. It contains one domain: the ion transport protein (Evalue: 1x10⁻⁸) whose function is to selectively transport ions through the membrane. It is possible that this protein is an integral membrane protein that has a critical function in facilitating ion transport. Transmembrane Ion Channel Family proteins that are found in eukaryotes tend to have up to four additional transmembrane helices. These additional helices help explain the physical properties of the protein. We have determined that TIT1 has a sequence that consists of 604 amino acids, a relatively lengthy sequence. Paragraph by: Kristiana Kim and Will Su(undergraduates), Keck Science Department, Scripps College, Claremont McKenna College | TIC1 |
| 34 | Tetrahymena thermophila gene CUT1 (Common Unknown Trans-membrane) protein is a trans-membrane protein with unknown function. This gene is closely related to a similar gene in Ichthyophthirius multifiliis. It contains two CLPTM1 functional domains, one of which is more strongly conserved than the other. When expressed in the human genome, this domain is known to be linked to cleft lip and palate. This family (CLPTM 1) is one of many eukaryotic, trans membrane protein sequences that are linked to cleft lip and palate; however, specific function is unknown. Paragraph provided by Kristina Millar and Caroline Hays, undergraduates at the Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges. | |
| 35 | Tetrahymena thermophila PKD1 (protein kinase domain) is homologous with other protein kinase-like proteins that are involved in catalytic functions and phosphorylation in cellular processes. PKD1 is located near the C-terminus of the protein appears to contain only one known domain (E-value= 1.2x10-42) in the protein kinase family although the substrate specificity of the PKD1 is unknown. Paragraph by: Victoria Nguyen and Joseph Grotts (undergraduates), Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges. | PKD1 |
| 36 | This protein is the in domain of sugar transporter with an E-value of 1.5X10-66, indicating that the sequence contains strongly conserved amino acids typical of the domain. . These types of transporters come from the Major Facilitator Superfamily (MFS) that are responsible for binding and then transporting several different molecules such as sugars, carbohydrates, and small, biological acids. While much is unknown about this specific transporter, it most likely is involved in the binding and transport of sugars across the cell membrane. Written by Jessica Thomas and Paul Gonzalez, undergraduates at the Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges. | STP1 |
| 37 | ATA2 from the eukaryote Tetrahymena thermophila is similar to ATA homologs from other eukaryotes. It contains two of each of the two types of domains, an ATP binding cassette (ABC) and a less conserved transmembrane domain (TMD), totaling four domains. The 3D structure of an ABC is a stubby L-shape with two distinct arms. These transporters function as dimers. The purpose of the binding cassettes (approximately 200 amino acid residues) is to bind and hydrolysis ATP, which releases energy that enables the transporters to transfer macromolecules and ions across cellular membranes. This most commonly occurs in the transport of essential nutrients to bacteria, but also is related to diseases such as cystic fibrosis in humans. It is clear that ATA2 is important as we can see that it is strongly conserved across many organisms from Homo sapiens to Drosophila. Paragraph provided by Aish Subramanian and Travis Tu, undergraduates at the Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges. | |
| 38 | Tetrahymena thermophilia MSC1 has similarities with different protein solute carriers from bacterial organisms. It contains only one domain characteristic to UAA transporters, which has a specificity for UDP-N-acetylglucosamine. The protein is largely located on the membrane of the eukaryote. Investigation into the family of UAA transporter proteins still remains largely untouched. Paragraph provided by undergraduates at the Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges. | MSC1 |
| 39 | Tetrahymena thermophile ASH3 (Assistant for the prevention of Shock due to Heat) is homologous with TCP-1/cpn60 chaperonin family of heat shock proteins. This family plays a major role in cell growth by assisting with the folding of denatured or partially denatured polypeptides when heat shock occurs in the cell. Because they do not denature in a wide range of temperatures, they are an important domain of heat shock proteins, which are mainly found in prokaryotes, chloroplasts, and mitochondria. Kate Jesse and Ashley Gould, undergraduates at the Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges. | CCT3 |
| 40 | Tetrahymena thermophila gene CUT1 (Common Unknown Trans-membrane) protein is a trans-membrane protein with unknown function. This gene is closely related to a similar gene in Ichthyophthirius multifiliis. It contains two CLPTM1 functional domains, one of which is more strongly conserved than the other. When expressed in the human genome, this domain is known to be linked to cleft lip and palate. This family (CLPTM 1) is one of many eukaryotic, trans membrane protein sequences that are linked to cleft lip and palate; however, specific function is unknown. Kristina Millar and Caroline Hays, undergraduates at the Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges. | CUT1 |
| 41 | Two domains on Tetrahymena thermophila MTP1 suggest that it belongs to the BT1 family. The proteins of this family are transport proteins, suggesting that MTP1 is also a transporter. Many proteins of this family are thought to be pteridine transporters, so it is possible that MTP1 also transports pteridine. By Nicole Hohnstein and Emilie Fisher, undergraduates at the Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges. | MTP1 |
| 42 | APF1 (Assistant Protein Folder) is homologous with members of the TCP-1/cpn60 chaperonin family and is found in abundance in prokaryotes, chloroplasts and mitochondria. It contains one domain (E-value= 7.8x10-136) that is possibly used to stabilize and protect disassembled polypeptides under heat shock conditions. In addition to its role as a heat shock protein, they may also function to assist in amino acid chain folding into their three-dimensional protein structures. This paragraph was provided by Hannah Chia and Jesse Honig, undergraduates at the Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges. | CCT2 |
| 43 | Tetrahymena thermophila ICT1 is homologous to the natural resistance-associated macrophage protein (NRAMP) family, composed of membrane proteins that are divalent cation transporters. It contains one domain (E-value=3.7x10-108), which is located in the middle of the protein. Given the function of the homologous proteins, it is likely that ICT1 is an integral membrane protein and functions as a cation transporter. Paragraph by: Alec Koh and Katherine Tully (undergraduates), Keck Science Department, Claremont McKenna College and Scripps College. | ICT1 |
| 44 | Tetrahymena thermophila STD1 (Sugar Transport and Distribution) is homologous to proteins from the major facilitator/general substrate transporter superfamily of proteins. It contains a single domain (E-value = 9.6 * 10-42) categorized as “sugar_tr,” which is responsible for sugar and other solute transportation across a membrane. This implies that STD1 integral membrane protein may be involved in the transport of sugars across the T. thermophila membrane. Paragraph by Daivik Vyas and Katie Liu, Keck Science Department, Claremont McKenna College and Scripps College. | STD1 |
| 45 | ATA2 from the eukaryote Tetrahymena thermophila is similar to ATA homologs from other eukaryotes. It contains two of each of the two types of domains, an ATP binding cassette (ABC) and a less conserved transmembrane domain (TMD), totaling four domains. The 3D structure of an ABC is a stubby L-shape with two distinct arms. These transporters function as dimers. The purpose of the binding cassettes (approximately 200 amino acid residues) is to bind and hydrolyze ATP, which releases energy that enables the transporters to transfer macromolecules and ions across cellular membranes. This most commonly occurs in the transport of essential nutrients to bacteria, but also is related to diseases such as cystic fibrosis in humans. It is clear that ATA2 is important as we can see that it is strongly conserved across many organisms from Homo sapiens to Drosophila. Paragraph provided by Aish Subramanian and Travis Tu at the Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges. | ATA2 |
| 46 | Tetrahymena thermophilia AKM1 (Advancer of K+ through the cell Membrane) contains one identified functional domain: the ion channel family (E-value 1.8 X 10 〖10〗^(-12)). It is most closely related to Ichthyophthirius multifilis EGR28840.1, a small-conductance, calcium-activated potassium channel protein. It is likely that AKM1 has a similar conformation as this protein. AKM1 is expected to be a tetrameric potassium channel, located in the phospholipid bilayer and contains a “loop” which is involved in the selectivity of ions that may pass through the channel. Paragraph by: Makari Krause and Amanda McQuade (undergraduates), Keck Science Department, Claremont McKenna, Pitzer, and Scripps Colleges. | AKM1 |
| 47 | The gene model is incorrect. The cDNA sequence, as determined by RT-PCR, is: ATGAGTTTAGTTTAGAGAACAATATAGGCTTATGAGAAGGATGAAAACAAAAACTTCGAAGAGTTCATTGAAAAAAGTTTAAAAGCATTTAGAGAAGAAGGTATGAAATTCGAGTAGTAAAAGGAGTGCAATTCGTAATAAATGTCTGATAACTAAAGAAACGAATGGGAAGAAAAAATAGCTAGTTTGGAAAGTCTTTTTAAAATGTTTTGTGTGCTTAAAGGTTAAAAGAGAAAGAAATCAAGAGTCATGTATAACATTTGTGAGCATATTTATGGAAAGAATTTACTAAAAAGAACATTTTGGTGCTGGAAAAGCCACCAGAAGAATGAAGAATATCTGCGTTAGATGGAAGAGTAAGCAGATGTATTTTATAACAGAAGGACACTAACAAAAATAATGAGAAGTTGGTAAGATGTTGTAATTGATGAGAATAAAACAATAGTTAAAAACACTGCCTTAAAGAAAACTGAGTTAGAATTGCAAAAAAATCAAAAGGAGTTTGAAAACCAAATTAAGAGTTTGGAAATTTTGCTATAATAAAAAATATTAACACTGAGACATGAAGAATAACAATACAACATTTTATTCTAAAAATAATAGCTCCTTTCATAAAATTAAAAAATTGAATTTGATTGA The corresponding protein sequence is: MSLVQRTIQAYEKDENKNFEEFIEKSLKAFREEGMKFEQQKECNSQQMSDNQRNEWEEKIASLESLFKMFCVLKGQKRKKSRVMYNICEHIYGKNLLKRTFWCWKSHQKNEEYLRQMEEQADVFYNRRTLTKIMRSWQDVVIDENKTIVKNTALKKTELELQKNQKEFENQIKSLEILLQQKILTLRHEEQQYNILFQKQQLLSQNQKIEFD | SFR1 |
| 48 | The gene prediction is incorrect. The cDNA sequence, as determined by RT-PCR, is: ATGGCATCCTTATTTAGGAGCGAGGAGCAAGCAATTTAAGAAATTATAAAGCTTATCCCTAACAATAGCGAAGACATATCAATTTTCGATATTTTGAAAGCTTACGATACATATATAGAGGAAAGTGGAATTAGCTTTGAAGATCCTTTTGCATATGATGTTTATGAAATTATCATTCATGCATCTAGAAGAGCACAAGACAATCAACTTAGGAGTTTGTTGACAAATTACAAAGAAATATAAAAATTAAAAATGAAATAAAACAGAAAAAATTCTGGGTATTCTGACAATAGTGATAACTCAGAGAAACCATATTCAAAGCAAAAGTTAGCCAAGTAAAAAATATCAAGCAAGTTCAGCAGTAAAAATTAGTCACTTTCACCAACCAACTTTGGTGTGAATAATTAAAAAAATGATAGAAAAGAATACAACATATAGTTTAAAAATTTTGATACCAGCTCAGGTGAAGAAAACGATAATAATTTTGTAAATAAAGAAATAAATGAAATATAAGATATTGAGCATACTCCTAGCTCTCAATATGAATAATAATAAGTGAGAGGAAGACTTGGATAATACCAACAATTTGCATCTAAAATTATTAATTCAGGTTTGAAAATGTCTAATCCTTTTAATGATAATTTATATAGATATGCAACAGAATAAGCAGATTAGCCTAATCGTTATAGCATTAGAAAGTATAGCTACTCTCCAAACAATAAAATGGATAGTAATAATAATCTAAAAAGGTCAGCATCTCCTATTTGTCATCCTAATAATAGAAGCCTTTCACCTCACTTAAACAATTCAAAACTCTCTAACTACCAAGCAAGATTAAACACTAGTAATTCTCACAATAATTCATTTAATAGTAGTGTTAATTAGCAATAGTCTTAAAGAGTAAGATTTAATACACAGAATGCTGATGAATATGTCAATATTTAAAGCCCTTTAAATTCAATTAACAACTTTTAGGCCAACAGATAGATGAAAGGTAATTTGGAGCAAATATAATAAAGAAGATTTATCTAAGAAAATTAGCACTAAACTCTCAATAGATCCATTGATAATTCAGATTTAAATTCAAAGGTAAATGGCATAGATAATAAAAAATATTTATCATTAGAACCTAAAGATTATCAATAATATTAATTTATGCCAGCTAATCATAAAAAATATTTATCTCTTGATTCAAGCACTAAACAAATGCTTAAGTATGAAAATTAAGATAACGAAAAATAAAACTAAGAAAATGTGTAGTACAATTTTGAAAATAGACACAGAAGTATTGAGGAAATAGAGGAAGATATTGATTTAGTTAGAAATGAAATGGCTCAAGGATTAAGAAGAAAATGGGTACTACATTACCATTTTGCAAACTGGAAAGATTATATTTAAAGATGGAAAGGAGCAACTGAATACATAAATAAGGAGGAATAAGTAGAAAATTTTATTAAAATCAAGATTTAAAGGAAATTTTTCGAAAAATGGGAATAATATGTATAAGAAGAAAATACTTGGAAAGAAGCAAAATTAAATTTTGTTATGAAAAAAAGATAGAATATTTTAAGAAAATGCTTCAATGAATTAAGAGATAGATTAAATGATGGAAAAATTGATAAATATACTTATTATGCAGCAAAATACAAAAAAGAATAAGTTTTAAAGGAAAAGTACTTTTAAAAATTTTTATAGTTCTCCAGAAATCATAGATCAAATAGGTTAAAATTGGAAAGGACACAATAAACTGCCTAAAATAACTTAAAAAAACTAGCTTTTAATCATTTAAAATAGTTAAAATCTGAAAAAAAAGAACGCCAGATAATAAAAGATGATATTAAAATGAAATAAAGTCTGCTTGAAAAGAAAATATCATTTGACAGATTTATTAATAATATAAGATCCATTCTTTGTTTTAAGAAGAAAAAAGAAATACTCAATAAAGCTATAGAAATATAGTTAAAATAGCATTCTCTTTTATCTATGATAGATAACTTTAGAATCATTAAGTATTTCAAAATTTAAGATCAAAGAGCAAGTGAATTTTATAATAAAAATTTATCATCTAAGTTTTTCTATCACTTGAAGTTATTTTTATTTAATAACAGAGAAAGAGTTGAAAATACAGAGAGCTATAATTAACTTAGAATTATAAATAAGCATCATAAATAATGGCAAAAATTTGTTTAACTGAATAAAAGTAAAGAATAAAAATACAAAGATGCGAGAATTCTTTACTTTTTGTATAGAATGATGATTATGATATTAAATGATAACGATTACTAAATTAGTCAGTAAAGAAATATTCAATTTGAGGCTTTTAAAGAATAAGTTTTATACTTATAAAAAATGAATTAAATACTTAATAATTAGCAATAAAAAGAAAATTATTAGTCTTTTGGTAAAGGAGAGAGCGAAGATGAATAAATTGATCCCACTCACTAATCTATGATGCAAAACTCAAGTAGCAATAATAATTTAATGTCAAATCATAAAAAATTACTGCCTAACTAAAAGAGTAAAAATTATTTATTCTCTAGAAGCACTCAAGCAACAGCTATGGGGAATAATGTTAATCCAAATCAAGTTTTTGATACTGTTAGATCCTTCTCTCCTGCCCCTGCAAGATAACATGATAATAAAACTTCTAGAAATGAAAACCATAATCAAGATTAATAATTCTTATCAGAAAATGACTAAAGCGATAATCAGCGTATGCAAAGAAATCTATCTGAATAAAATTTTGTTTATTAAACTCAAAGATAGTCTTAGAGCAATATACTAAAAGTATATGAAAATTAAGAGATGATGAATGAGTAATAAATAAATGAAGAAATTGCAATTTAAATAATAGGACATGGAATATTTTTTACTTATCCTAGTATACTATCTATAAATTATTATAACAAAACTCAAACAGAAAAATTATTTTAATCTCATAGAAATTTAAATCAATTCATTTTAAGTAAGTCTTTTAAGAATTGGGTGACTTTCTTAAGATCAAGAAATGACTTTAGAAAGAAGATGTTAAATAAAATTTATTAAAAACATTTTGATGCCATGAAAATTTATTCTACAAAATCTTAATGTTTAAGATTTTGTGTTGAAAAAATGCAGAAAAAGCTAAATAAAAAGACTGTCGAAAATGTTTTTAGAGAAATGAGTTTAAGAGCTTAAGAGAGAAAAAATTCAAGAAATGGTTTTAAAATAATAAGAGAAAAGATAGAGAAAAAATTACTTTAAAAATACTTTAAGATTTATAGAAGAGAATTTTCTTCATCACGTGGATATTCTGAAAACTATGAATAAGCTGGCATTTATTATAAAAAATGGCTTATTGTTTAATCTTTCCAAGCTATCTAAAATTATGCAAATAGATAAAAAATGGTAAGAGATGTCATTTCAACAAAATTCTAAACTAAAAGCTAAAACTAAATGAGTAGAATATTCTTTGCCTGGAGAATTTATTCTGATAAAAGAAGATAAAGAAACTTTATATATTAACAAATTAGATAGATATATGAAAAAAAGGTTTATAAAGAATGTTTATTTGCATTAGCAAATTATAGAGATAAACACTCAAAGTCAACAAAGAATAAAAATATTGTGAAATCTTATTTGTTTAACAAATATATTGTGAACACTTTCTAAAAAATACTAAATTATTCTAAAAGTCATAAAATAAAAAGTATTTTGACTGATAAAATTAGAATTGCATATAAGCAAAAGCTTATGTAGAATTATCTCCATAAACTTAAAGATTATAAAAATTATAGACAAAAGAAAGTAACTCTCCAAGCAAAAAATACTGAGAAAGTAGAAAAAGTATTTCAAAAAAAGCATTTTAGGGCTTGGTACAAGCTAGGATGTAGAAATTAAAGCTTCCGTTACTTAGTTGATTTAGTAAAAAGACTATAATTAAGTAGATTTTTTGTTATCATGAAATATTTACGTTAAAGGGATTTCTAAAAGCAAAAAATTATTAAAAGTGATCATCTAATCTTCTTAAAATTAACTATTTTTAATGCTTTTGTTAAGTATTACAGAAAAAGAAAATATGAAAGAAAGAGTCTTGAATATATAAAATGTAGATAACAAATTAATTATGCCAAGTAATCTATGAAGTAATGGAAGAAATTGCATTCATACAATAAAAATGTAACATATTTATGTGCAAAGTCAATCATAGCTATCAAAAACGAAATACTTTTAAAGTACTTTAATAAACTTAAATAAAAATGGTTCTTAAAATCATAAGAAAACAAGTTTATAAAGGAAAATCAAATTAAGATGAAGAGAAAAATCTTACTTGGATTAAGAAAATATACAACTTATAAAATAAATAACTATGAAAACATGATAGCTATCAATGAAAAAAGAAAGAAATAGATTAAATAAAACATTCTATATATTTGGCTCAGAAAGTTATTTAATAAATAGCGTCAAGAAGACGTCTCTAGGGCTATTATTAAATACAGAAA | SFR13 |
| 49 | The continuation of the cDNA sequence is: GCATAAAGTACTTCAAACTTGGGCTGATTTGTTTAACATCAAAAATAACCTACATAATCCAGTTAAAGTTTCTGATTTTCAAGGATTTAAGAGATTAGAAGAAACATAAGAAATACATATCATCACAACAAATAGAGGCAAAAAAAGAAACTTAAGATAGTTTTTCTTTAATATGTTGAAATTAAATTAAAAAATTTTACAACAAAAAGTCTTTTCATGTTTAAAAAACTTAATTAATGAAAGAAAAATTGAGAATAAAAAATCAGATTAAATTTAATTTAAATGTGAAACTGATTTATTAACAAAGTACCTTCTGCAATGGTAAAAATCTAGTCAAAAGAAAATAAATAAGTATAATATGATAGTAAAATTACGAAGTGTATTTTAAAAGTATTAAAAGAGGATTGGGTTTGAAGCTATTTAAGGATAAGAATAAATTTATTTGGAATTAATACAAAAATCCAAAAAGGCTGTAACTTAAAGACAAAAATCCATTAAAATGAAAAGTTTTAACAAGCTTAAAGCATACTATCTTAAGAAAAGAAAAATAGCTAAGAGAAAGCTGGAACTTGATGAACTTGTATAGAGAAATAACACTCTAAATTTCTTTAAAAAGCTAAAGTTTTATGCATATAAAAAGTAGGAAAATAAATAAAAGAATGTATATATCTAAGATTATTTATACTTAAATTTGCTTAAAAAGGTGTTTAATAAGATAAGAACATACTAAATAATTAAGTAGACTTTAGCTTAAAAATCTCTTAAACTTTAATCTTACTTAAATAAAAAGAAGCTTAGAAGAGGATTTAAATAAATTTAATAAAACTTTTCTGAAAGTAAAAGTGATATGTAAAATACCATTTAATCATTAAAGGCTTACAGAATGAATCTTCAGCTTAAATCATTCGCTGTTCTAAGAAAATACATGAATATTTAAAAATTGAAAAGCTAAAAATATAATAGTGCTTTTAATAAATATTATTTTAGTTTAGCTACAAGAATATTTGGAGCATTAAAGACATATATACTCAATAAAAATATTGAAAAAGATAATCATTTGTATATCCTTGATTAATATCGTTAAAGAAAATAAGTCGAAATAAAGAAGGGAATTTTGATGGTTTGGAAATACTACACTAATTAAAGTATAAATCAAGTCTAGCAATTTAGGTCTTGCATTGAAGCTTCAGTTCTAAAATCTAAGTTTGTTGAATGGAAGATTAAGACTCATCTTCTCAAAGATAAGAGAATGAAATATAACATTATTAAAAATTCTAATAATTATAAGCTAAGAGCTAAGCTATTCAAATTATGGTAGTAAAGGGCAAAGCTGAATTTAGTCCTTACAAATATTTTTGTCTATCATGCAAAAATAGAAATTAAAAAAAGACTTTTAAAGTGGAATCAATCTAAAAACTTGTTGAAAAAAATAGTGAACAAATCTTAATAACAAGTTATTTCTAAACCTAGATCAGCAGATGATATTTAAAAAATGAGATAAGTATTTTGCATGATCAAAGAAATGGCTTAAAATACACATTCAATTAAGAAGGATTAAAATTTAAGATAAAAGTAAATTAATGACCAAAATGTCTTTAAGTAGTTTACTTTGCAATTTAAAGCTTCATAATTAGCAGAAAAATTAAATCAGCTAAGATACTTCTCTTCTGCTCAATAATTTATTTTTAATCTAAAGCAAATGTACATTTAAAAAAAGTAGGACAAAGCTCTTGCTAAGAAATCTGAAAGACTAAATTCTCCTAAATTCTAAAAAAACTAAATCAAGAATTCCATGATTTAGCAAACTCTTAAAGAACAAAAGTTAAAGGATGAATTTTAAAAGTTAAGTAAATTAATAAGCAGAAAGCAAAAAGAGTTACTCAGTGGTAGCTTGCTAAACTTAAAAGATTTTGTTAACTACTAAAATAATATTTAAATTCAAGCTAATTTACATCATGATAGGTAGCTACAGTAAAAAACTTTCAAACTTTGGAAAAAGTTTGTTGAAAGTTCCAAGCAATTTTCAAGTGTGCTAGGATAGGTGTTAACTAAGGCTTTAAAAAGATGCTAATAATAGAAATTGAGAGATGCTTTTAGATAAATATAAATCAGATATATAAAAATTAAAGCTGCTAATATAGTTTCTAGCTGTATTGATAGATCAGTAAAGCGCTAATACGCTTAAAAATTATTTGAACTTTACGAGTAATTTAAATCAAAAACACAAGTACTAAGATATTTAATTGAAAACCATTAAATAAAAATGAACACATAAAGAGCAATTTAGTTCTTTAACATTCTAAAAAATCTAAAAATTCAAGCTGAACGCTCAAAGATGAAGTGTAAAGAATATCTATTCATTAGAAGAATAAAATAAATGAAATCAGTCTTGACAATATTATAAATCTATACTCAGTATAGAAGAAACAAAAATGACAGATACTAAAAAGCTCATTTATTTTGGGAAAACAAATCCAAATAAAAATACCTTTATTTCTGGGCCAGAGCTTATTAAAACGCCTAACAATATGAGGAATACTAATAAGATCAATTCGATTAGTAAGAATTTTATGAGTAACAATAAAAATTAGTTGAGAATGAACTTATGTAATAATTGGCTTTACACCATCAGCAATAAGTAAACTAATAAGGAAACATTTAGTAACTAACAAAATAAGAGCAAGAAGAGTAGTTGCGTTATCTTTAGCAATAATATGAAATTTTGAAGTAGCAGTAGCAGTAAATGTTGTAAAAATAATAATAAACTTATCACCAATAAAACTAACAACAAAATTAAAGATATCTAAGTAATTAATCAGAATAATTTTAATCTGATGAGAACGAATATTATAATGAAGAACCAGTAACTTACAGTGATGCAAATTACATAAATATACCTATTAACTATAATCCTAATTCCAATTATGATTAAAATATTGGTATTTAGTAAAAAATAAATTAAATTTAGCAAGAGAATAAATATGATTATCAAGACTAAGACATGGCAGATTTACTTTTTGACAAACCAAGATAATATATTCCCTAATAGCAAAGACAGCAAATTTAGAGTTATGAAAACATTTAAAAGCAATCAAACATAATTCAATAAGAACATCTCATTATCAAAGAGCAAAGTGAGGAACATGAGTCAGGTAATGATTCTTAATTGTAAAAGTATTTGAGAGAGTCCTAATCTTATAATTAAGAGAATTAAAATGACTCTTATTAAAATGATCAAGAAAATAAATCTTAAGAAAGAGAAAGTAAAATAGAATCATATTAAATTTAAAGTTAAAATGAGTCATATGAATAAATTCATTCCTACTAACAGTAAGATAAAGATATTCATTAGCATGATCATGAATTAGTTTAATAAAATTAAAACTAAAGTTAAGGATAAGATTAACATGAAGAATAATAATACACATTTAGCTAAGACGAATAAAAAAGTTCATCTAATACATCTAAAAATATTTTAAATAATAATTATGAACAATAACAATAAAATTTAAGTAATTAGTAATAAAATATGATATAATAATAGTAATTAATTCAATAACAGTAGTAGCAACTGTTATAATAGCTCTAGTAGGCTTAACAATAAAAACAAATAAACATGAGCTTTGAGAATATTGATTAAAATTAAGCAGATAAATCTTAAGTAGAGGATTATAAGGAAGATGATTTTTATAATTAAGGCGAATTTTTGGAATAATCTGAAGAAGATTCTTAAGAATAAACAAATTTTATGCTTTAACAATATTTATTATAGAAGCAAGAGTCATTTGTTCAAATGGTCTTCAATGTTTGGCGCAAATTTACTATAGACAAAAAAATTAAAAGAAATTAAGAAGAAGAAGCTATCGAAACAGCTTATTAAGTTTATGAAAATAATTTGAGCAGGAGAGTATTTTTAGAGTGGAAAGAAGTATGCTAAGAAAGAATTAATATGAGCAAGTAACAAATGAGATCCTACTTATATGCTTGCTTTTCAAGCTGGAAAATGTTTTCTAAGGAAAAAAAATTACTAAAAAAATATTTATCTGAAGCTGAGTTGGATGAACAATTAGCCTACACTCCTTAAACAACCGACAGGCTAAATCTTCTTTTTAATAATAACGATCCTAGATCTTCTTAATAAAAATTTTAGAGATCTGGGTCTTATAATAATTTAGAAGGATCTAACAAAACTTCCTCTGATTCATAAAAGAGTGTATCGTTAGCAAGCGCACTCTTTACTGGAAAGCTCAAAATTTAAGATACTTCTAATTTGGATAAAAATGCTCCTCATTGA | SFR13 |
| 50 | The predicted protein sequence based on the cDNA sequence determined by RT-PCR is: MASLFRSEEQAIQEIIKLIPNNSEDISIFDILKAYDTYIEESGISFEDPFAYDVYEIIIHASRRAQDNQLRSLLTNYKEIQKLKMKQNRKNSGYSDNSDNSEKPYSKQKLAKQKISSKFSSKNQSLSPTNFGVNNQKNDRKEYNIQFKNFDTSSGEENDNNFVNKEINEIQDIEHTPSSQYEQQQVRGRLGQYQQFASKIINSGLKMSNPFNDNLYRYATEQADQPNRYSIRKYSYSPNNKMDSNNNLKRSASPICHPNNRSLSPHLNNSKLSNYQARLNTSNSHNNSFNSSVNQQQSQRVRFNTQNADEYVNIQSPLNSINNFQANRQMKGNLEQIQQRRFIQENQHQTLNRSIDNSDLNSKVNGIDNKKYLSLEPKDYQQYQFMPANHKKYLSLDSSTKQMLKYENQDNEKQNQENVQYNFENRHRSIEEIEEDIDLVRNEMAQGLRRKWVLHYHFANWKDYIQRWKGATEYINKEEQVENFIKIKIQRKFFEKWEQYVQEENTWKEAKLNFVMKKRQNILRKCFNELRDRLNDGKIDKYTYYAAKYKKEQVLKEKYFQKFLQFSRNHRSNRLKLERTQQTAQNNLKKLAFNHLKQLKSEKKERQIIKDDIKMKQSLLEKKISFDRFINNIRSILCFKKKKEILNKAIEIQLKQHSLLSMIDNFRIIKYFKIQDQRASEFYNKNLSSKFFYHLKLFLFNNRERVENTESYNQLRIINKHHKQWQKFVQLNKSKEQKYKDARILYFLYRMMIMILNDNDYQISQQRNIQFEAFKEQVLYLQKMNQILNNQQQKENYQSFGKGESEDEQIDPTHQSMMQNSSSNNNLMSNHKKLLPNQKSKNYLFSRSTQATAMGNNVNPNQVFDTVRSFSPAPARQHDNKTSRNENHNQDQQFLSENDQSDNQRMQRNLSEQNFVYQTQRQSQSNILKVYENQEMMNEQQINEEIAIQIIGHGIFFTYPSILSINYYNKTQTEKLFQSHRNLNQFILSKSFKNWVTFLRSRNDFRKKMLNKIYQKHFDAMKIYSTKSQCLRFCVEKMQKKLNKKTVENVFREMSLRAQERKNSRNGFKIIREKIEKKLLQKYFKIYRREFSSSRGYSENYEQAGIYYKKWLIVQSFQAIQNYANRQKMVRDVISTKFQTKSQNQMSRIFFAWRIYSDKRRQRNFIYQQIRQIYEKKVYKECLFALANYRDKHSKSTKNKNIVKSYLFNKYIVNTFQKILNYSKSHKIKSILTDKIRIAYKQKLMQNYLHKLKDYKNYRQKKVTLQAKNTEKVEKVFQKKHFRAWYKLGCRNQSFRYLVDLVKRLQLSRFFVIMKYLRQRDFQKQKIIKSDHLIFLKLTIFNAFVKYYRKRKYERKSLEYIKCRQQINYAKQSMKQWKKLHSYNKNVTYLCAKSIIAIKNEILLKYFNKLKQKWFLKSQENKFIKENQIKMKRKILLGLRKYTTYKINNYENMIAINEKRKKQIKQNILYIWLRKLFNKQRQEDVSRAIIKYRKHKVLQTWADLFNIKNNLHNPVKVSDFQGFKRLEETQEIHIITTNRGKKRNLRQFFFNMLKLNQKILQQKVFSCLKNLINERKIENKKSDQIQFKCETDLLTKYLLQWQKSSQKKINKYNMIVKLRSVFQKYQKRIGFEAIQGQEQIYLELIQKSKKAVTQRQKSIKMKSFNKLKAYYLKKRKIAKRKLELDELVQRNNTLNFFKKLKFYAYKKQENKQKNVYIQDYLYLNLLKKVFNKIRTYQIIKQTLAQKSLKLQSYLNKKKLRRGFKQIQQNFSESKSDMQNTIQSLKAYRMNLQLKSFAVLRKYMNIQKLKSQKYNSAFNKYYFSLATRIFGALKTYILNKNIEKDNHLYILDQYRQRKQVEIKKGILMVWKYYTNQSINQVQQFRSCIEASVLKSKFVEWKIKTHLLKDKRMKYNIIKNSNNYKLRAKLFKLWQQRAKLNLVLTNIFVYHAKIEIKKRLLKWNQSKNLLKKIVNKSQQQVISKPRSADDIQKMRQVFCMIKEMAQNTHSIKKDQNLRQKQINDQNVFKQFTLQFKASQLAEKLNQLRYFSSAQQFIFNLKQMYIQKKQDKALAKKSERLNSPKFQKNQIKNSMIQQTLKEQKLKDEFQKLSKLISRKQKELLSGSLLNLKDFVNYQNNIQIQANLHHDRQLQQKTFKLWKKFVESSKQFSSVLGQVLTKALKRCQQQKLRDAFRQIQIRYIKIKAANIVSSCIDRSVKRQYAQKLFELYEQFKSKTQVLRYLIENHQIKMNTQRAIQFFNILKNLKIQAERSKMKCKEYLFIRRIKQMKSVLTILQIYTQYRRNKNDRYQKAHLFWENKSKQKYLYFWARAYQNAQQYEEYQQDQFDQQEFYEQQQKLVENELMQQLALHHQQQVNQQGNIQQLTKQEQEEQLRYLQQQYEILKQQQQQMLQKQQQTYHQQNQQQNQRYLSNQSEQFQSDENEYYNEEPVTYSDANYINIPINYNPNSNYDQNIGIQQKINQIQQENKYDYQDQDMADLLFDKPRQYIPQQQRQQIQSYENIQKQSNIIQQEHLIIKEQSEEHESGNDSQLQKYLRESQSYNQENQNDSYQNDQENKSQERESKIESYQIQSQNESYEQIHSYQQQDKDIHQHDHELVQQNQNQSQGQDQHEEQQYTFSQDEQKSSSNTSKNILNNNYEQQQQNLSNQQQNMIQQQQLIQQQQQQLLQQLQQAQQQKQINMSFENIDQNQADKSQVEDYKEDDFYNQGEFLEQSEEDSQEQTNFMLQQYLLQKQESFVQMVFNVWRKFTIDKKIKRNQEEEAIETAYQVYENNLSRRVFLEWKEVCQERINMSKQQMRSYLYACFSSWKMFSKEKKLLKKYLSEAELDEQLAYTPQTTDRLNLLFNNNDPRSSQQKFQRSGSYNNLEGSNKTSSDSQKSVSLASALFTGKLKIQDTSNLDKNAPH | SFR13 |
| 51 | Tetrahymena thermophilia CRP1 (calcium regulator protein 1) appears to be a member of the sodium/calcium exchanger protein family. It contains one putative sodium/calcium exchanger domain, which has an E-value of 3.2*10^-13, indicating that it is reasonably related to this domain sequence. It is possible that this protein regulates Ca2+ cation concentration within the cell, where the movement of Ca2+ in or out of the cytoplasm is contingent upon the concentration of Na+ in the cell. M. Huen and M. Greeley | CRP1 |
| 52 | deleted | |
| 53 | In yeast, DNA-dependent ATPase that stimulates strand exchange; modifies the topology of double-stranded DNA; involved in the recombinational repair of double-strand breaks in DNA during vegetative growth and meiosis | RAD54 |
| 54 | Hop2 and Mnd1 are meiosis-specific proteins that function in a complex in budding yeast. Their general architecture is strikingly similar, and therefore they are potentially homologous protein families. The Hop2-Mnd1 system seems to have undergone duplication in the evolutionary history of Tetrahymena, because both protein families are represented by two homologs with distinct expression patterns in this species. Just as for HOP2 (meiotic) and HOPP2 (ubiquitous), there is a meiotic (MND1)and a ubiquitously expressed (MNDP1) version, which raises the possibility that a meiotic and a ubiquitous Mnd1p-Hop2p complex exists. | HOP2, HOPP2, MNDP1, MND1 |
| 58 | Named RPL8 in Klinge et al. Science 2011 | |
| 59 | Gene Model error: The open reading frame for the major protein product starts at an upstream in-frame ATG, adding 17 amino acids to the N-terminus of the predicted protein (Couvillion et al., Mol. Cell, 2012). | TWI12 |
| 60 | Gene Information: TTHERM_00865050 is a homolog of annotated and functionally characterized Orc1 in other experimental organisms (24% amino acid sequence identity, 49% similarity to human Orc1). Orc1 is a component of the heterohexameric origin recognition complex (ORC) found to be involved in initiation of DNA replication. TtOrc1 has canonical Walker A and B motifs (involved in ATP binding and hydrolysis). TtORC is unusual in that it contains an integral RNA subunit (26T RNA) that binds to its cognate DNA target in the ribosomal DNA (rDNA) replication origin. Identified in: Tetrahymena ORC contains a ribosomal RNA fragment that participates in rDNA origin recognition Mohammad M Mohammad,1,*† Taraka R Donti,1,* J Sebastian Yakisich,1 Aaron G Smith,2 and Geoffrey M Kapler1,2,a PMID: 2140106 Characterization of a novel origin recognition complex-like complex: implications for DNA recognition, cell cycle control, and locus-specific gene amplification. Mohammad M, York RD, Hommel J, Kapler GM. Mol Cell Biol. 2003 Jul;23(14):5005-17. PMID:12832485 Differential targeting of Tetrahymena ORC to ribosomal DNA and non-rDNA replication origins. Donti TR, Datta S, Sandoval PY, Kapler GM. PMID: 19153611 Nucleic Acid Interactions (with the ORC complex): 26T RNA (5’-AUGUCUAAGUGUGAUGAUAAACGAAAAAAAAUAAAAAUUAA-3’). Type I element T-rich strand: essential cis-acting replication determinant in ribosomal DNA origin of replication. (Location 5’ non-transcribed spacer) (C3 rDNA type IB element T-rich strand, T51: 5’-CTCAAAAGTTGCAAAAGTTCGGAAGGTTTACTATTTTTGTTTTTTTTTT-3’). – requires 26T RNA and ATP dsDNA – non rDNA chromosomes Protein Interaction Partners: TtOrc2 (Co-migration on a native gel, detection by WB). Biochemical Activities (of ORC complex): ATP binding, likely ATP hydrolysis DNA binding - typeI element T-rich strand DNA RNA binding – 26T RNA Regulation & Expression: mRNA and protein: Cell cycle regulated Maximal protein expression at G1/S border, degraded in S phase | |
| 61 | Gene Information: TTHERM_00865050 is a homolog of annotated and functionally characterized Orc1 in other experimental organisms (24% amino acid sequence identity, 49% similarity to human Orc1). Orc1 is a component of the heterohexameric origin recognition complex (ORC) found to be involved in initiation of DNA replication. TtOrc1 has canonical Walker A and B motifs (involved in ATP binding and hydrolysis). TtORC is unusual in that it contains an integral RNA subunit (26T RNA) that binds to its cognate DNA target in the ribosomal DNA (rDNA) replication origin. | ORC1 |
| 62 | Nucleic Acid Interactions (with the ORC complex): 26T RNA (5’-AUGUCUAAGUGUGAUGAUAAACGAAAAAAAAUAAAAAUUAA-3’). Type I element T-rich strand: essential cis-acting replication determinant in ribosomal DNA origin of replication. (Location 5’ non-transcribed spacer) (C3 rDNA type IB element T-rich strand, T51: 5’-CTCAAAAGTTGCAAAAGTTCGGAAGGTTTACTATTTTTGTTTTTTTTTT-3’). – requires 26T RNA and ATP dsDNA – non rDNA chromosomes | ORC1 |
| 63 | Protein Interaction Partners: TtOrc2 (Co-migration on a native gel, detection by WB). | ORC1 |
| 64 | Biochemical Activities (of ORC complex): ATP binding, likely ATP hydrolysis DNA binding - typeI element T-rich strand DNA RNA binding – 26T RNA | ORC1 |
| 65 | Regulation & Expression: mRNA and protein: Cell cycle regulated Maximal protein expression at G1/S border, degraded in S phase | ORC1 |
| 66 | Gene Information: TTHERM_00684560 against human ORC subunit 2 protein e-value= 8e-16 Reverse BLAST of NP_006181.1 against TGD: TTHERM_00684560 hypothetical protein e-value= 8e-15. | TTHERM_00684560 |
| 67 | The conserved Origin Recognition Complex (ORC) determines the sites for replication initiation in eukaryotic chromosomes and serves as a scaffold for pre-replicative complex (pre-RC) assembly. Although ORC subunits are conserved in eukaryotes, the cis-acting DNA sequence requirements for replicator function are not. | TTHERM_00684560 |
| 68 | Nucleic Acid Interactions: Orc2p bound to streptavidin sepharose in 26T RNA aptamer-tagged strains (TD152 and MM202, respectively) | TTHERM_00684560 |
| 69 | Protein Interaction Partners: Tetrahymena thermophila ORC physically associates with Orc1p in western blotting (native gel electrophoresis and immunoprecipitation analyses. Western blotting was similarly used to monitor the migration of nuclease-treated ORC complexes under native EMSA gel conditions. The mobility of Orc1p and Orc2p increased following MNase and RNase A treatment, but was unaltered by DNase I (Figure 3D). Orc1p and Orc2p co-migrated under all conditions, suggesting that they remain associated after the RNA is destroyed. | TTHERM_00684560 |
| 70 | Biochemical Activities: Consistent with previous analyses of Orc2p/Tt-p69 and histone H3 (Mohammad et al, 2003), ∼50% of Orc2 was rendered soluble by DNase I. TtORC also crossreacts with a rabbit polyclonal antibodies raised against Xenopus laevis / Orc2p. | TTHERM_00684560 |
| 71 | Regulation & Expression: Orc2p crossreactive subunit, Tt-p69, localizes to the macronucleus during vegetative S phase. Cell cycle regulated Maximal protein expression at G1/S border | TTHERM_00684560 |
| 72 | Gene Information: MCM6 is a gene coding for a protein product associated with replicative origins in G1 phase during pre-replicative complex assembly. ORC recruits MCM6p on non-rDNA chromosomes. Mcm6p ChIP analysis was performed with affinity-purified rabbit antibodies directed against amino acids 34–51 (GKKIKYYREKALLLKIYE) of the T. thermophila MCM6 protein (Tetrahymena Genome Database gene prediction: TTHERM-00448570, e value versus human MCM6 (NP_005906.2): 1.0e-172. Human MCM6 (NP_005906.2) versus TGD TTHERM-0048570 e value : 1.0e-178. | MCM6 |
| 73 | Nucleic Acid Interactions: Non-rDNA and rDNA origin in cells synchronized at the G1/S border. | MCM6 |
| 74 | Protein Interaction Partners: Not assessed | MCM6 |
| 75 | Biochemical Activities: Predicted helicase activity for dsDNA as a component of MCM2-7 complex | MCM6 |
| 76 | Gene Information: Tif1 is a non-ORC Type-I binding factor associated with ssDNA, particularly rDNA associated with replication initiation. Essential cis-acting replication determinant in ribosomal DNA origin of replication. (Location 5’ non-transcribed spacer) Limited homology to Whirly family proteins in plants (transcription factors that bind to single strand DNA target sequences), but this homology is restricted to the DNA binding domain. | TIF1 |
| 77 | Nucleic Acid Interactions: Tif1 assocates with the A-rich strand of rDNA in vivo, and can be purified to associate with the T-rich strand in vitro. | TIF1 |
| 78 | Biochemical Activities: Regulates timing of rDNA origin activation. Involved in the S phase DNA damage checkpoint response. Involved in unique ssDNA origin of replication recognition. TIF1 disruption mutants are hypersensitive to hydroxyurea and methylmethanesulfonate, inducers of DNA damage in all examined eukaryotes. | TIF1 |
| 79 | Regulation & Expression: TIF1 interacts with A-rich strand at the rDNA origins and the T-rich strand at the rDNA promoter. TIF1p localization is dynamically regulated as it moves into the micro- and macronucleus during the respective S phases. | TIF1 |
| 80 | Gene Information: The phosphatidylinositol 3-kinase (PI3K)-related sensor kinase ATR is a key player in the signaling of induced DNA damage and self-inflicted DNA cuts in vegetative and meiotic cells (Richardson et al., 2004; Bassing and Alt, 2004; Hunter, 2008). In higher eukaryotes ATR is recruited by the MRX/MRN complex and possibly other unknown factors to the sites of damage and phosphorylates a host of target proteins to arrest replication forks and prevent new origins from firing. (Kurz and Lees-Miller, 2004). TTHERM_01008650 BLAST against human ATR1 NP_001175.2 e value : 6.0 e-5. Reverse BLAST of human ATR1 (NP_001175.2) against TTHERM_01008650 e value : 3e-48 | ATR1 |
| 81 | Nucleic Acid Interactions: Involved in ssDNA binding at rDNA origin and promoter. Sensing and repair mechanisms unknown. | ATR1 |
| 82 | Protein Interaction Partners: Not determined | ATR1 |
| 83 | Biochemical Activities: Ability to arrest cell cycle is inhibited by caffeine. | ATR1 |
| 84 | Regulation & Expression: Activated / Induced by DNA damage | ATR1 |
| 85 | Gene Information: ASI2 is a gene regulating endocycling in Tetrahymena thermophila. Though nonessential for vegative growth, it is upregulated after meiosis and is involved in the creation of a new MAC. Introduced via transduction with ASI2-GFP plasmid to establish parental cells that showed transcription of ASI2 occurs both in MAC and parental cells at conjugation. | ASI2 |
| 86 | Nucleic Acid Interactions: ASI2p independent of ssRNA synthesis/accumulation | ASI2 |
| 87 | Regulation & Expression: The Tetrahymena gene ASI1 (anlagen stage induced 1) was isolated from a cDNA library of genes that are up-regulated during development of the macronuclear anlagen. As its name implies, the abundance of ASI2 mRNA peaks at 9 h of mating, early in macronuclear anlagen development. | ASI2 |