Identifiers and Description

Gene Model Identifier

TTHERM_00105330

Standard Name

RPS28 (Ribosomal Protein of the Small subunit 28)

Aliases

PreTt23033 | 7.m00482

Description

Homolog of yeast RPS28, human RPS28;

Genome Browser (Macronucleus)

GBrowse

Genome Browser (Micronucleus)

GBrowse

Gene Ontology Annotations

Cellular Component

Molecular Function

Biological Process

Domains

  • ( PF01200 ) ribosomal protein S28e

Gene Expression Profile

  • Tetrahymena Functional Genomics Database:

Change in Gene Expression

TMHMM

TMHMM

Signal Peptide

Signal Peptide Present?: No
Presense Probability: 10.3%

TetraMine Data

TTHERM_00105330

WebApollo

Fullscreen View

Tetrahymena Stock Center

No Data fetched for StockID

Homologs (v.2006 protein sequences)

SourceIdentifierScoreDescription
Tetrahymena borealisEI9_00370.15.998312950603665e-35ribosomal protein S28e contain
ing protein (69 aa)
OxytrichaContig12436.0.g462.99851380290819e-19Ribosomal protein S28e
SGDYOR167C4.0009493637353324e-18RPS28A Protein component of th
e small (40S) ribosomal subuni
t; nearly identical to Rps28Bp
and has similarity to rat S28
ribosomal protein
WormBaseWBGene000044977.9993595954329e-16locus:rps-28 40S ribosomal p
rotein S28 status:Confirmed
UniProt:Q95Y04 protein_id:
CCD66705.1
DictyBaseDDB_G02855970.000000000000020000882446601127rps28 on chromosome: 4 positio
n 3428530 to 3429424

General Information

No Data fetched for General Information

Associated Literature

  1. Ref:21205638: Rabl J, Leibundgut M, Ataide SF, Haag A, Ban N (2011) Crystal structure of the eukaryotic 40S ribosomal subunit in complex with initiation factor 1. Science (New York, N.Y.) 331(6018):730-6

Sequences

>TTHERM_00105330(coding)
ATGAATACCGAAGAAACTACTAAGGCTAGAATTATGGATGTCCTCGGAAAGACTGGTTCC
AGAGGTGGTATTACCCAAGTTAGAGTCGTATTGATCAGTGGTAAGGAAGAAGGTAGATAA
CTTATTAGAAACGTCAAGGGTGCCTGCAGAGTCGGTGACGTCCTCGAACTTATGGAATGT
GAAAGAGAAGCCAGAAGATTAAGATGA


>TTHERM_00105330(protein)
MNTEETTKARIMDVLGKTGSRGGITQVRVVLISGKEEGRQLIRNVKGACRVGDVLELMEC
EREARRLR


>TTHERM_00105330(gene)
ATGAATACCGAAGAAACTACTAAGGCTAGAATTATGGATGTCCTCGGAAAGACTGGTAAT
TAATTTAAGATATGAATCACTTCAAATAGTGAACGCGAAAAATTTCCTGAAAAGTTTAGA
TGAAATTTTTGAAAATTAGTTGCCATTTCTCCATTTGAGGAGGGAGCATTATTAATTCAT
AATGCTCAAAATATATATTCATTTGAATACAAATAAAAGCGACTTTAATATGTTCAGTGA
TAGAAAAATGATTGAATTATCATAAAAGGAATAAAAAAATAAAATGGTTTTTTGGGAATT
TTCGCTTATCAACTAGATTTTGTGATGATTTTATTGATGAAATTAAAGAAATGAAAGAAG
GAAATTTTAATAATATTTTTATCTATTTTTATAGGTTCCAGAGGTGGTATTACCCAAGTT
AGAGTCGTATTGATCAGTGGTAAGGAAGAAGGTAGATAACTTATTAGAAACGTCAAGGGT
GCCTGCAGAGTCGGTGACGTCCTCGAACTTATGGAATGTGAAAGAGAAGCCAGAAGATTA
AGATGA